TUX: Penguin Power!
Linux| Perl| PHP| Webserv| Databases| Sysadmin| Programming| Filesystems| Java| Webprog

Make Tux happy: Link to us!


DESCRIPTION
       This page provides a basic tutorial on understanding, creating and
       using regular expressions in Perl.  It serves as a complement to the
       reference page on regular expressions perlre.  Regular expressions are
       an integral part of the "m//", "s///", "qr//" and "split" operators and
       so this tutorial also overlaps with "Regexp Quote-Like Operators" in
       perlop and "split" in perlfunc.

       Perl is widely renowned for excellence in text processing, and regular
       expressions are one of the big factors behind this fame.  Perl regular
       expressions display an efficiency and flexibility unknown in most other
       computer languages.  Mastering even the basics of regular expressions
       will allow you to manipulate text with surprising ease.

       What is a regular expression?  A regular expression is simply a string
       that describes a pattern.  Patterns are in common use these days;
       examples are the patterns typed into a search engine to find web pages
       and the patterns used to list files in a directory, e.g., "ls *.txt" or
       "dir *.*".  In Perl, the patterns described by regular expressions are
       used to search strings, extract desired parts of strings, and to do
       search and replace operations.

       Regular expressions have the undeserved reputation of being abstract
       and difficult to understand.  Regular expressions are constructed using
       simple concepts like conditionals and loops and are no more difficult
       to understand than the corresponding "if" conditionals and "while"
       loops in the Perl language itself.  In fact, the main challenge in
       learning regular expressions is just getting used to the terse notation
       used to express these concepts.

       This tutorial flattens the learning curve by discussing regular
       expression concepts, along with their notation, one at a time and with
       many examples.  The first part of the tutorial will progress from the
       simplest word searches to the basic regular expression concepts.  If
       you master the first part, you will have all the tools needed to solve
       about 98% of your needs.  The second part of the tutorial is for those
       comfortable with the basics and hungry for more power tools.  It
       discusses the more advanced regular expression operators and introduces
       the latest cutting edge innovations in 5.6.0.

       A note: to save time, 'regular expression' is often abbreviated as
       regexp or regex.  Regexp is a more natural abbreviation than regex, but
       is harder to pronounce.  The Perl pod documentation is evenly split on
       regexp vs regex; in Perl, there is more than one way to abbreviate it.
       We'll use regexp in this tutorial.

Part 1: The basics
   Simple word matching
       The simplest regexp is simply a word, or more generally, a string of
       characters.  A regexp consisting of a word matches any string that
       contains that word:

           "Hello World" =~ /World/;  # matches
           }
           else {
               print "It doesn't match\n";
           }

       There are useful variations on this theme.  The sense of the match can
       be reversed by using the "!~" operator:

           if ("Hello World" !~ /World/) {
               print "It doesn't match\n";
           }
           else {
               print "It matches\n";
           }

       The literal string in the regexp can be replaced by a variable:

           $greeting = "World";
           if ("Hello World" =~ /$greeting/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }

       If you're matching against the special default variable $_, the "$_ =~"
       part can be omitted:

           $_ = "Hello World";
           if (/World/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }

       And finally, the "//" default delimiters for a match can be changed to
       arbitrary delimiters by putting an 'm' out front:

           "Hello World" =~ m!World!;   # matches, delimited by '!'
           "Hello World" =~ m{World};   # matches, note the matching '{}'
           "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
                                        # '/' becomes an ordinary char

       "/World/", "m!World!", and "m{World}" all represent the same thing.
       When, e.g., the quote (""") is used as a delimiter, the forward slash
       '/' becomes an ordinary character and can be used in this regexp
       without trouble.

       Let's consider how different regexps would match "Hello World":

           "Hello World" =~ /world/;  # doesn't match
           "Hello World" =~ /o W/;    # matches
           "Hello World" =~ /oW/;     # doesn't match

       If a regexp matches in more than one place in the string, Perl will
       always match at the earliest possible point in the string:

           "Hello World" =~ /o/;       # matches 'o' in 'Hello'
           "That hat is red" =~ /hat/; # matches 'hat' in 'That'

       With respect to character matching, there are a few more points you
       need to know about.   First of all, not all characters can be used 'as
       is' in a match.  Some characters, called metacharacters, are reserved
       for use in regexp notation.  The metacharacters are

           {}[]()^$.|*+?\

       The significance of each of these will be explained in the rest of the
       tutorial, but for now, it is important only to know that a
       metacharacter can be matched by putting a backslash before it:

           "2+2=4" =~ /2+2/;    # doesn't match, + is a metacharacter
           "2+2=4" =~ /2\+2/;   # matches, \+ is treated like an ordinary +
           "The interval is [0,1)." =~ /[0,1)./     # is a syntax error!
           "The interval is [0,1)." =~ /\[0,1\)\./  # matches
           "#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/;  # matches

       In the last regexp, the forward slash '/' is also backslashed, because
       it is used to delimit the regexp.  This can lead to LTS (leaning
       toothpick syndrome), however, and it is often more readable to change
       delimiters.

           "#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!;  # easier to read

       The backslash character '\' is a metacharacter itself and needs to be
       backslashed:

           'C:\WIN32' =~ /C:\\WIN/;   # matches

       In addition to the metacharacters, there are some ASCII characters
       which don't have printable character equivalents and are instead
       represented by escape sequences.  Common examples are "\t" for a tab,
       "\n" for a newline, "\r" for a carriage return and "\a" for a bell.  If
       your string is better thought of as a sequence of arbitrary bytes, the
       octal escape sequence, e.g., "\033", or hexadecimal escape sequence,
       e.g., "\x1B" may be a more natural representation for your bytes.  Here
       are some examples of escapes:

           "1000\t2000" =~ m(0\t2)   # matches
           "1000\n2000" =~ /0\n20/   # matches
           "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
           "cat"        =~ /\143\x61\x74/ # matches, but a weird way to spell cat

       If you've been around Perl a while, all this talk of escape sequences
       may seem familiar.  Similar escape sequences are used in double-quoted
       strings and in fact the regexps in Perl are mostly treated as double-
       quoted strings.  This means that variables can be used in regexps as
       well.  Just like double-quoted strings, the values of the variables in
           % cat > simple_grep
           #!/usr/bin/perl
           $regexp = shift;
           while (<>) {
               print if /$regexp/;
           }
           ^D

           % chmod +x simple_grep

           % simple_grep abba /usr/dict/words
           Babbage
           cabbage
           cabbages
           sabbath
           Sabbathize
           Sabbathizes
           sabbatical
           scabbard
           scabbards

       This program is easy to understand.  "#!/usr/bin/perl" is the standard
       way to invoke a perl program from the shell.  "$regexp = shift;" saves
       the first command line argument as the regexp to be used, leaving the
       rest of the command line arguments to be treated as files.
       "while (<>)" loops over all the lines in all the files.  For each line,
       "print if /$regexp/;" prints the line if the regexp matches the line.
       In this line, both "print" and "/$regexp/" use the default variable $_
       implicitly.

       With all of the regexps above, if the regexp matched anywhere in the
       string, it was considered a match.  Sometimes, however, we'd like to
       specify where in the string the regexp should try to match.  To do
       this, we would use the anchor metacharacters "^" and "$".  The anchor
       "^" means match at the beginning of the string and the anchor "$" means
       match at the end of the string, or before a newline at the end of the
       string.  Here is how they are used:

           "housekeeper" =~ /keeper/;    # matches
           "housekeeper" =~ /^keeper/;   # doesn't match
           "housekeeper" =~ /keeper$/;   # matches
           "housekeeper\n" =~ /keeper$/; # matches

       The second regexp doesn't match because "^" constrains "keeper" to
       match only at the beginning of the string, but "housekeeper" has keeper
       starting in the middle.  The third regexp does match, since the "$"
       constrains "keeper" to match only at the end of the string.

       When both "^" and "$" are used at the same time, the regexp has to
       match both the beginning and the end of the string, i.e., the regexp
       matches the whole string.  Consider

           "keeper" =~ /^keep$/;      # doesn't match
           "keeper" =~ /^keeper$/;    # matches
           "bertram" =~ /^bert/;  # matches, so still not good enough

           "bertram" =~ /^bert$/; # doesn't match, good
           "dilbert" =~ /^bert$/; # doesn't match, good
           "bert"    =~ /^bert$/; # matches, perfect

       Of course, in the case of a literal string, one could just as easily
       use the string comparison "$string eq 'bert'" and it would be more
       efficient.   The  "^...$" regexp really becomes useful when we add in
       the more powerful regexp tools below.

   Using character classes
       Although one can already do quite a lot with the literal string regexps
       above, we've only scratched the surface of regular expression
       technology.  In this and subsequent sections we will introduce regexp
       concepts (and associated metacharacter notations) that will allow a
       regexp to not just represent a single character sequence, but a whole
       class of them.

       One such concept is that of a character class.  A character class
       allows a set of possible characters, rather than just a single
       character, to match at a particular point in a regexp.  Character
       classes are denoted by brackets "[...]", with the set of characters to
       be possibly matched inside.  Here are some examples:

           /cat/;       # matches 'cat'
           /[bcr]at/;   # matches 'bat, 'cat', or 'rat'
           /item[0123456789]/;  # matches 'item0' or ... or 'item9'
           "abc" =~ /[cab]/;    # matches 'a'

       In the last statement, even though 'c' is the first character in the
       class, 'a' matches because the first character position in the string
       is the earliest point at which the regexp can match.

           /[yY][eE][sS]/;      # match 'yes' in a case-insensitive way
                                # 'yes', 'Yes', 'YES', etc.

       This regexp displays a common task: perform a case-insensitive match.
       Perl provides a way of avoiding all those brackets by simply appending
       an 'i' to the end of the match.  Then "/[yY][eE][sS]/;" can be
       rewritten as "/yes/i;".  The 'i' stands for case-insensitive and is an
       example of a modifier of the matching operation.  We will meet other
       modifiers later in the tutorial.

       We saw in the section above that there were ordinary characters, which
       represented themselves, and special characters, which needed a
       backslash "\" to represent themselves.  The same is true in a character
       class, but the sets of ordinary and special characters inside a
       character class are different than those outside a character class.
       The special characters for a character class are "-]\^$" (and the
       pattern delimiter, whatever it is).  "]" is special because it denotes
       the end of a character class.  "$" is special because it denotes a
       scalar variable.  "\" is special because it is used in escape
       sequences, just like above.  Here is how the special characters "]$\"

       The special character '-' acts as a range operator within character
       classes, so that a contiguous set of characters can be written as a
       range.  With ranges, the unwieldy "[0123456789]" and "[abc...xyz]"
       become the svelte "[0-9]" and "[a-z]".  Some examples are

           /item[0-9]/;  # matches 'item0' or ... or 'item9'
           /[0-9bx-z]aa/;  # matches '0aa', ..., '9aa',
                           # 'baa', 'xaa', 'yaa', or 'zaa'
           /[0-9a-fA-F]/;  # matches a hexadecimal digit
           /[0-9a-zA-Z_]/; # matches a "word" character,
                           # like those in a Perl variable name

       If '-' is the first or last character in a character class, it is
       treated as an ordinary character; "[-ab]", "[ab-]" and "[a\-b]" are all
       equivalent.

       The special character "^" in the first position of a character class
       denotes a negated character class, which matches any character but
       those in the brackets.  Both "[...]" and "[^...]" must match a
       character, or the match fails.  Then

           /[^a]at/;  # doesn't match 'aat' or 'at', but matches
                      # all other 'bat', 'cat, '0at', '%at', etc.
           /[^0-9]/;  # matches a non-numeric character
           /[a^]at/;  # matches 'aat' or '^at'; here '^' is ordinary

       Now, even "[0-9]" can be a bother to write multiple times, so in the
       interest of saving keystrokes and making regexps more readable, Perl
       has several abbreviations for common character classes, as shown below.
       Since the introduction of Unicode, these character classes match more
       than just a few characters in the ISO 8859-1 range.

       o   \d matches a digit, not just [0-9] but also digits from non-roman
           scripts

       o   \s matches a whitespace character, the set [\ \t\r\n\f] and others

       o   \w matches a word character (alphanumeric or _), not just
           [0-9a-zA-Z_] but also digits and characters from non-roman scripts

       o   \D is a negated \d; it represents any other character than a digit,
           or [^\d]

       o   \S is a negated \s; it represents any non-whitespace character
           [^\s]

       o   \W is a negated \w; it represents any non-word character [^\w]

       o   The period '.' matches any character but "\n" (unless the modifier
           "//s" is in effect, as explained below).

       The "\d\s\w\D\S\W" abbreviations can be used both inside and outside of
       character classes.  Here are some in use:
       "[^\d\w]" is the same as "[^\w]", which is the same as "[\W]". Think
       DeMorgan's laws.

       An anchor useful in basic regexps is the word anchor "\b".  This
       matches a boundary between a word character and a non-word character
       "\w\W" or "\W\w":

           $x = "Housecat catenates house and cat";
           $x =~ /cat/;    # matches cat in 'housecat'
           $x =~ /\bcat/;  # matches cat in 'catenates'
           $x =~ /cat\b/;  # matches cat in 'housecat'
           $x =~ /\bcat\b/;  # matches 'cat' at end of string

       Note in the last example, the end of the string is considered a word
       boundary.

       You might wonder why '.' matches everything but "\n" - why not every
       character? The reason is that often one is matching against lines and
       would like to ignore the newline characters.  For instance, while the
       string "\n" represents one line, we would like to think of it as empty.
       Then

           ""   =~ /^$/;    # matches
           "\n" =~ /^$/;    # matches, $ anchors before "\n"

           ""   =~ /./;      # doesn't match; it needs a char
           ""   =~ /^.$/;    # doesn't match; it needs a char
           "\n" =~ /^.$/;    # doesn't match; it needs a char other than "\n"
           "a"  =~ /^.$/;    # matches
           "a\n"  =~ /^.$/;  # matches, $ anchors before "\n"

       This behavior is convenient, because we usually want to ignore newlines
       when we count and match characters in a line.  Sometimes, however, we
       want to keep track of newlines.  We might even want "^" and "$" to
       anchor at the beginning and end of lines within the string, rather than
       just the beginning and end of the string.  Perl allows us to choose
       between ignoring and paying attention to newlines by using the "//s"
       and "//m" modifiers.  "//s" and "//m" stand for single line and multi-
       line and they determine whether a string is to be treated as one
       continuous string, or as a set of lines.  The two modifiers affect two
       aspects of how the regexp is interpreted: 1) how the '.' character
       class is defined, and 2) where the anchors "^" and "$" are able to
       match.  Here are the four possible combinations:

       o   no modifiers (//): Default behavior.  '.' matches any character
           except "\n".  "^" matches only at the beginning of the string and
           "$" matches only at the end or before a newline at the end.

       o   s modifier (//s): Treat string as a single long line.  '.' matches
           any character, even "\n".  "^" matches only at the beginning of the
           string and "$" matches only at the end or before a newline at the
           end.

       o   m modifier (//m): Treat string as a set of multiple lines.  '.'
           $x =~ /^Who/;   # doesn't match, "Who" not at start of string
           $x =~ /^Who/s;  # doesn't match, "Who" not at start of string
           $x =~ /^Who/m;  # matches, "Who" at start of second line
           $x =~ /^Who/sm; # matches, "Who" at start of second line

           $x =~ /girl.Who/;   # doesn't match, "." doesn't match "\n"
           $x =~ /girl.Who/s;  # matches, "." matches "\n"
           $x =~ /girl.Who/m;  # doesn't match, "." doesn't match "\n"
           $x =~ /girl.Who/sm; # matches, "." matches "\n"

       Most of the time, the default behavior is what is wanted, but "//s" and
       "//m" are occasionally very useful.  If "//m" is being used, the start
       of the string can still be matched with "\A" and the end of the string
       can still be matched with the anchors "\Z" (matches both the end and
       the newline before, like "$"), and "\z" (matches only the end):

           $x =~ /^Who/m;   # matches, "Who" at start of second line
           $x =~ /\AWho/m;  # doesn't match, "Who" is not at start of string

           $x =~ /girl$/m;  # matches, "girl" at end of first line
           $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string

           $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
           $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string

       We now know how to create choices among classes of characters in a
       regexp.  What about choices among words or character strings? Such
       choices are described in the next section.

   Matching this or that
       Sometimes we would like our regexp to be able to match different
       possible words or character strings.  This is accomplished by using the
       alternation metacharacter "|".  To match "dog" or "cat", we form the
       regexp "dog|cat".  As before, Perl will try to match the regexp at the
       earliest possible point in the string.  At each character position,
       Perl will first try to match the first alternative, "dog".  If "dog"
       doesn't match, Perl will then try the next alternative, "cat".  If
       "cat" doesn't match either, then the match fails and Perl moves to the
       next position in the string.  Some examples:

           "cats and dogs" =~ /cat|dog|bird/;  # matches "cat"
           "cats and dogs" =~ /dog|cat|bird/;  # matches "cat"

       Even though "dog" is the first alternative in the second regexp, "cat"
       is able to match earlier in the string.

           "cats"          =~ /c|ca|cat|cats/; # matches "c"
           "cats"          =~ /cats|cat|ca|c/; # matches "cats"

       Here, all the alternatives match at the first string position, so the
       first alternative is the one that matches.  If some of the alternatives
       are truncations of the others, put the longest ones first to give them
       a chance to match.

       For instance, suppose we want to search for housecats or housekeepers.
       The regexp "housecat|housekeeper" fits the bill, but is inefficient
       because we had to type "house" twice.  It would be nice to have parts
       of the regexp be constant, like "house", and some parts have
       alternatives, like "cat|keeper".

       The grouping metacharacters "()" solve this problem.  Grouping allows
       parts of a regexp to be treated as a single unit.  Parts of a regexp
       are grouped by enclosing them in parentheses.  Thus we could solve the
       "housecat|housekeeper" by forming the regexp as "house(cat|keeper)".
       The regexp "house(cat|keeper)" means match "house" followed by either
       "cat" or "keeper".  Some more examples are

           /(a|b)b/;    # matches 'ab' or 'bb'
           /(ac|b)b/;   # matches 'acb' or 'bb'
           /(^a|b)c/;   # matches 'ac' at start of string or 'bc' anywhere
           /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'

           /house(cat|)/;  # matches either 'housecat' or 'house'
           /house(cat(s|)|)/;  # matches either 'housecats' or 'housecat' or
                               # 'house'.  Note groups can be nested.

           /(19|20|)\d\d/;  # match years 19xx, 20xx, or the Y2K problem, xx
           "20" =~ /(19|20|)\d\d/;  # matches the null alternative '()\d\d',
                                    # because '20\d\d' can't match

       Alternations behave the same way in groups as out of them: at a given
       string position, the leftmost alternative that allows the regexp to
       match is taken.  So in the last example at the first string position,
       "20" matches the second alternative, but there is nothing left over to
       match the next two digits "\d\d".  So Perl moves on to the next
       alternative, which is the null alternative and that works, since "20"
       is two digits.

       The process of trying one alternative, seeing if it matches, and moving
       on to the next alternative, while going back in the string from where
       the previous alternative was tried, if it doesn't, is called
       backtracking.  The term 'backtracking' comes from the idea that
       matching a regexp is like a walk in the woods.  Successfully matching a
       regexp is like arriving at a destination.  There are many possible
       trailheads, one for each string position, and each one is tried in
       order, left to right.  From each trailhead there may be many paths,
       some of which get you there, and some which are dead ends.  When you
       walk along a trail and hit a dead end, you have to backtrack along the
       trail to an earlier point to try another trail.  If you hit your
       destination, you stop immediately and forget about trying all the other
       trails.  You are persistent, and only if you have tried all the trails
       from all the trailheads and not arrived at your destination, do you
       declare failure.  To be concrete, here is a step-by-step analysis of
       what Perl does when it tries to match the regexp

           "abcde" =~ /(abd|abc)(df|d|de)/;

       0   Start with the first letter in the string 'a'.
       5   Move on to the second group and pick the first alternative 'df'.

       6   Match the 'd'.

       7   'f' in the regexp doesn't match 'e' in the string, so a dead end.
           Backtrack one character and pick the second alternative in the
           second group 'd'.

       8   'd' matches. The second grouping is satisfied, so set $2 to 'd'.

       9   We are at the end of the regexp, so we are done! We have matched
           'abcd' out of the string "abcde".

       There are a couple of things to note about this analysis.  First, the
       third alternative in the second group 'de' also allows a match, but we
       stopped before we got to it - at a given character position, leftmost
       wins.  Second, we were able to get a match at the first character
       position of the string 'a'.  If there were no matches at the first
       position, Perl would move to the second character position 'b' and
       attempt the match all over again.  Only when all possible paths at all
       possible character positions have been exhausted does Perl give up and
       declare "$string =~ /(abd|abc)(df|d|de)/;" to be false.

       Even with all this work, regexp matching happens remarkably fast.  To
       speed things up, Perl compiles the regexp into a compact sequence of
       opcodes that can often fit inside a processor cache.  When the code is
       executed, these opcodes can then run at full throttle and search very
       quickly.

   Extracting matches
       The grouping metacharacters "()" also serve another completely
       different function: they allow the extraction of the parts of a string
       that matched.  This is very useful to find out what matched and for
       text processing in general.  For each grouping, the part that matched
       inside goes into the special variables $1, $2, etc.  They can be used
       just as ordinary variables:

           # extract hours, minutes, seconds
           if ($time =~ /(\d\d):(\d\d):(\d\d)/) {    # match hh:mm:ss format
               $hours = $1;
               $minutes = $2;
               $seconds = $3;
           }

       Now, we know that in scalar context, "$time =~ /(\d\d):(\d\d):(\d\d)/"
       returns a true or false value.  In list context, however, it returns
       the list of matched values "($1,$2,$3)".  So we could write the code
       more compactly as

           # extract hours, minutes, seconds
           ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);

       If the groupings in a regexp are nested, $1 gets the group with the
       leftmost opening parenthesis, $2 the next opening parenthesis, etc.
       associated with the rightmost closing parenthesis used in the match).

   Backreferences
       Closely associated with the matching variables $1, $2, ... are the
       backreferences "\1", "\2",...  Backreferences are simply matching
       variables that can be used inside a regexp.  This is a really nice
       feature -- what matches later in a regexp is made to depend on what
       matched earlier in the regexp.  Suppose we wanted to look for doubled
       words in a text, like 'the the'.  The following regexp finds all
       3-letter doubles with a space in between:

           /\b(\w\w\w)\s\1\b/;

       The grouping assigns a value to \1, so that the same 3 letter sequence
       is used for both parts.

       A similar task is to find words consisting of two identical parts:

           % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
           beriberi
           booboo
           coco
           mama
           murmur
           papa

       The regexp has a single grouping which considers 4-letter combinations,
       then 3-letter combinations, etc., and uses "\1" to look for a repeat.
       Although $1 and "\1" represent the same thing, care should be taken to
       use matched variables $1, $2,... only outside a regexp and
       backreferences "\1", "\2",... only inside a regexp; not doing so may
       lead to surprising and unsatisfactory results.

   Relative backreferences
       Counting the opening parentheses to get the correct number for a
       backreference is errorprone as soon as there is more than one capturing
       group.  A more convenient technique became available with Perl 5.10:
       relative backreferences. To refer to the immediately preceding capture
       group one now may write "\g{-1}", the next but last is available via
       "\g{-2}", and so on.

       Another good reason in addition to readability and maintainability for
       using relative backreferences  is illustrated by the following example,
       where a simple pattern for matching peculiar strings is used:

           $a99a = '([a-z])(\d)\2\1';   # matches a11a, g22g, x33x, etc.

       Now that we have this pattern stored as a handy string, we might feel
       tempted to use it as a part of some other pattern:

           $line = "code=e99e";
           if ($line =~ /^(\w+)=$a99a$/){   # unexpected behavior!
               print "$1 is valid\n";
           } else {

   Named backreferences
       Perl 5.10 also introduced named capture buffers and named
       backreferences.  To attach a name to a capturing group, you write
       either "(?<name>...)" or "(?'name'...)".  The backreference may then be
       written as "\g{name}".  It is permissible to attach the same name to
       more than one group, but then only the leftmost one of the eponymous
       set can be referenced.  Outside of the pattern a named capture buffer
       is accessible through the "%+" hash.

       Assuming that we have to match calendar dates which may be given in one
       of the three formats yyyy-mm-dd, mm/dd/yyyy or dd.mm.yyyy, we can write
       three suitable patterns where we use 'd', 'm' and 'y' respectively as
       the names of the buffers capturing the pertaining components of a date.
       The matching operation combines the three patterns as alternatives:

           $fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
           $fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
           $fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
           for my $d qw( 2006-10-21 15.01.2007 10/31/2005 ){
               if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
                   print "day=$+{d} month=$+{m} year=$+{y}\n";
               }
           }

       If any of the alternatives matches, the hash "%+" is bound to contain
       the three key-value pairs.

   Alternative capture group numbering
       Yet another capturing group numbering technique (also as from Perl
       5.10) deals with the problem of referring to groups within a set of
       alternatives.  Consider a pattern for matching a time of the day, civil
       or military style:

           if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
               # process hour and minute
           }

       Processing the results requires an additional if statement to determine
       whether $1 and $2 or $3 and $4 contain the goodies. It would be easier
       if we could use buffer numbers 1 and 2 in second alternative as well,
       and this is exactly what the parenthesized construct "(?|...)", set
       around an alternative achieves. Here is an extended version of the
       previous pattern:

           if ( $time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/ ){
               print "hour=$1 minute=$2 zone=$3\n";
           }

       Within the alternative numbering group, buffer numbers start at the
       same position for each alternative. After the group, numbering
       continues with one higher than the maximum reached across all the
       alternatives.

   Position information

       prints

           Match 1: 'Mmm' at position (0,3)
           Match 2: 'donut' at position (6,11)

       Even if there are no groupings in a regexp, it is still possible to
       find out what exactly matched in a string.  If you use them, Perl will
       set "$`" to the part of the string before the match, will set $& to the
       part of the string that matched, and will set "$'" to the part of the
       string after the match.  An example:

           $x = "the cat caught the mouse";
           $x =~ /cat/;  # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
           $x =~ /the/;  # $` = '', $& = 'the', $' = ' cat caught the mouse'

       In the second match, "$`" equals '' because the regexp matched at the
       first character position in the string and stopped; it never saw the
       second 'the'.  It is important to note that using "$`" and "$'" slows
       down regexp matching quite a bit, while $& slows it down to a lesser
       extent, because if they are used in one regexp in a program, they are
       generated for all regexps in the program.  So if raw performance is a
       goal of your application, they should be avoided.  If you need to
       extract the corresponding substrings, use "@-" and "@+" instead:

           $` is the same as substr( $x, 0, $-[0] )
           $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
           $' is the same as substr( $x, $+[0] )

   Non-capturing groupings
       A group that is required to bundle a set of alternatives may or may not
       be useful as a capturing group.  If it isn't, it just creates a
       superfluous addition to the set of available capture buffer values,
       inside as well as outside the regexp.  Non-capturing groupings, denoted
       by "(?:regexp)", still allow the regexp to be treated as a single unit,
       but don't establish a capturing buffer at the same time.  Both
       capturing and non-capturing groupings are allowed to co-exist in the
       same regexp.  Because there is no extraction, non-capturing groupings
       are faster than capturing groupings.  Non-capturing groupings are also
       handy for choosing exactly which parts of a regexp are to be extracted
       to matching variables:

           # match a number, $1-$4 are set, but we only want $1
           /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;

           # match a number faster , only $1 is set
           /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;

           # match a number, get $1 = whole number, $2 = exponent
           /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;

       Non-capturing groupings are also useful for removing nuisance elements
       gathered from a split operation where parentheses are required for some
       reason:
       This is exactly the problem the quantifier metacharacters "?", "*",
       "+", and "{}" were created for.  They allow us to delimit the number of
       repeats for a portion of a regexp we consider to be a match.
       Quantifiers are put immediately after the character, character class,
       or grouping that we want to specify.  They have the following meanings:

       o   "a?" means: match 'a' 1 or 0 times

       o   "a*" means: match 'a' 0 or more times, i.e., any number of times

       o   "a+" means: match 'a' 1 or more times, i.e., at least once

       o   "a{n,m}" means: match at least "n" times, but not more than "m"
           times.

       o   "a{n,}" means: match at least "n" or more times

       o   "a{n}" means: match exactly "n" times

       Here are some examples:

           /[a-z]+\s+\d*/;  # match a lowercase word, at least one space, and
                            # any number of digits
           /(\w+)\s+\1/;    # match doubled words of arbitrary length
           /y(es)?/i;       # matches 'y', 'Y', or a case-insensitive 'yes'
           $year =~ /\d{2,4}/;  # make sure year is at least 2 but not more
                                # than 4 digits
           $year =~ /\d{4}|\d{2}/;    # better match; throw out 3 digit dates
           $year =~ /\d{2}(\d{2})?/;  # same thing written differently. However,
                                      # this produces $1 and the other does not.

           % simple_grep '^(\w+)\1$' /usr/dict/words   # isn't this easier?
           beriberi
           booboo
           coco
           mama
           murmur
           papa

       For all of these quantifiers, Perl will try to match as much of the
       string as possible, while still allowing the regexp to succeed.  Thus
       with "/a?.../", Perl will first try to match the regexp with the "a"
       present; if that fails, Perl will try to match the regexp without the
       "a" present.  For the quantifier "*", we get the following:

           $x = "the cat in the hat";
           $x =~ /^(.*)(cat)(.*)$/; # matches,
                                    # $1 = 'the '
                                    # $2 = 'cat'
                                    # $3 = ' in the hat'

       Which is what we might expect, the match finds the only "cat" in the
       string and locks onto it.  Consider, however, this regexp:

       quantifier, if there is one, gets to grab as much the string as
       possible, leaving the rest of the regexp to fight over scraps.  Thus in
       our example, the first quantifier ".*" grabs most of the string, while
       the second quantifier ".*" gets the empty string.   Quantifiers that
       grab as much of the string as possible are called maximal match or
       greedy quantifiers.

       When a regexp can match a string in several different ways, we can use
       the principles above to predict which way the regexp will match:

       o   Principle 0: Taken as a whole, any regexp will be matched at the
           earliest possible position in the string.

       o   Principle 1: In an alternation "a|b|c...", the leftmost alternative
           that allows a match for the whole regexp will be the one used.

       o   Principle 2: The maximal matching quantifiers "?", "*", "+" and
           "{n,m}" will in general match as much of the string as possible
           while still allowing the whole regexp to match.

       o   Principle 3: If there are two or more elements in a regexp, the
           leftmost greedy quantifier, if any, will match as much of the
           string as possible while still allowing the whole regexp to match.
           The next leftmost greedy quantifier, if any, will try to match as
           much of the string remaining available to it as possible, while
           still allowing the whole regexp to match.  And so on, until all the
           regexp elements are satisfied.

       As we have seen above, Principle 0 overrides the others -- the regexp
       will be matched as early as possible, with the other principles
       determining how the regexp matches at that earliest character position.

       Here is an example of these principles in action:

           $x = "The programming republic of Perl";
           $x =~ /^(.+)(e|r)(.*)$/;  # matches,
                                     # $1 = 'The programming republic of Pe'
                                     # $2 = 'r'
                                     # $3 = 'l'

       This regexp matches at the earliest string position, 'T'.  One might
       think that "e", being leftmost in the alternation, would be matched,
       but "r" produces the longest string in the first quantifier.

           $x =~ /(m{1,2})(.*)$/;  # matches,
                                   # $1 = 'mm'
                                   # $2 = 'ing republic of Perl'

       Here, The earliest possible match is at the first 'm' in "programming".
       "m{1,2}" is the first quantifier, so it gets to match a maximal "mm".

           $x =~ /.*(m{1,2})(.*)$/;  # matches,
                                     # $1 = 'm'
                                     # $2 = 'ing republic of Perl'

       opportunity to match both "m"'s. Finally,

           "aXXXb" =~ /(X*)/; # matches with $1 = ''

       because it can match zero copies of 'X' at the beginning of the string.
       If you definitely want to match at least one 'X', use "X+", not "X*".

       Sometimes greed is not good.  At times, we would like quantifiers to
       match a minimal piece of string, rather than a maximal piece.  For this
       purpose, Larry Wall created the minimal match or non-greedy quantifiers
       "??", "*?", "+?", and "{}?".  These are the usual quantifiers with a
       "?" appended to them.  They have the following meanings:

       o   "a??" means: match 'a' 0 or 1 times. Try 0 first, then 1.

       o   "a*?" means: match 'a' 0 or more times, i.e., any number of times,
           but as few times as possible

       o   "a+?" means: match 'a' 1 or more times, i.e., at least once, but as
           few times as possible

       o   "a{n,m}?" means: match at least "n" times, not more than "m" times,
           as few times as possible

       o   "a{n,}?" means: match at least "n" times, but as few times as
           possible

       o   "a{n}?" means: match exactly "n" times.  Because we match exactly
           "n" times, "a{n}?" is equivalent to "a{n}" and is just there for
           notational consistency.

       Let's look at the example above, but with minimal quantifiers:

           $x = "The programming republic of Perl";
           $x =~ /^(.+?)(e|r)(.*)$/; # matches,
                                     # $1 = 'Th'
                                     # $2 = 'e'
                                     # $3 = ' programming republic of Perl'

       The minimal string that will allow both the start of the string "^" and
       the alternation to match is "Th", with the alternation "e|r" matching
       "e".  The second quantifier ".*" is free to gobble up the rest of the
       string.

           $x =~ /(m{1,2}?)(.*?)$/;  # matches,
                                     # $1 = 'm'
                                     # $2 = 'ming republic of Perl'

       The first string position that this regexp can match is at the first
       'm' in "programming". At this position, the minimal "m{1,2}?"  matches
       just one 'm'.  Although the second quantifier ".*?" would prefer to
       match no characters, it is constrained by the end-of-string anchor "$"
       to match the rest of the string.

       matches the rest of the string.

           $x =~ /(.??)(m{1,2})(.*)$/;  # matches,
                                        # $1 = 'a'
                                        # $2 = 'mm'
                                        # $3 = 'ing republic of Perl'

       Just as in the previous regexp, the first quantifier ".??" can match
       earliest at position 'a', so it does.  The second quantifier is greedy,
       so it matches "mm", and the third matches the rest of the string.

       We can modify principle 3 above to take into account non-greedy
       quantifiers:

       o   Principle 3: If there are two or more elements in a regexp, the
           leftmost greedy (non-greedy) quantifier, if any, will match as much
           (little) of the string as possible while still allowing the whole
           regexp to match.  The next leftmost greedy (non-greedy) quantifier,
           if any, will try to match as much (little) of the string remaining
           available to it as possible, while still allowing the whole regexp
           to match.  And so on, until all the regexp elements are satisfied.

       Just like alternation, quantifiers are also susceptible to
       backtracking.  Here is a step-by-step analysis of the example

           $x = "the cat in the hat";
           $x =~ /^(.*)(at)(.*)$/; # matches,
                                   # $1 = 'the cat in the h'
                                   # $2 = 'at'
                                   # $3 = ''   (0 matches)

       0   Start with the first letter in the string 't'.

       1   The first quantifier '.*' starts out by matching the whole string
           'the cat in the hat'.

       2   'a' in the regexp element 'at' doesn't match the end of the string.
           Backtrack one character.

       3   'a' in the regexp element 'at' still doesn't match the last letter
           of the string 't', so backtrack one more character.

       4   Now we can match the 'a' and the 't'.

       5   Move on to the third element '.*'.  Since we are at the end of the
           string and '.*' can match 0 times, assign it the empty string.

       6   We are done!

       Most of the time, all this moving forward and backtracking happens
       quickly and searching is fast. There are some pathological regexps,
       however, whose execution time exponentially grows with the size of the
       string.  A typical structure that blows up in your face is of the form

       other efficiency issues.

   Possessive quantifiers
       Backtracking during the relentless search for a match may be a waste of
       time, particularly when the match is bound to fail.  Consider the
       simple pattern

           /^\w+\s+\w+$/; # a word, spaces, a word

       Whenever this is applied to a string which doesn't quite meet the
       pattern's expectations such as "abc  " or "abc  def ", the regex engine
       will backtrack, approximately once for each character in the string.
       But we know that there is no way around taking all of the initial word
       characters to match the first repetition, that all spaces must be eaten
       by the middle part, and the same goes for the second word.

       With the introduction of the possessive quantifiers in Perl 5.10, we
       have a way of instructing the regex engine not to backtrack, with the
       usual quantifiers with a "+" appended to them.  This makes them greedy
       as well as stingy; once they succeed they won't give anything back to
       permit another solution. They have the following meanings:

       o   "a{n,m}+" means: match at least "n" times, not more than "m" times,
           as many times as possible, and don't give anything up. "a?+" is
           short for "a{0,1}+"

       o   "a{n,}+" means: match at least "n" times, but as many times as
           possible, and don't give anything up. "a*+" is short for "a{0,}+"
           and "a++" is short for "a{1,}+".

       o   "a{n}+" means: match exactly "n" times.  It is just there for
           notational consistency.

       These possessive quantifiers represent a special case of a more general
       concept, the independent subexpression, see below.

       As an example where a possessive quantifier is suitable we consider
       matching a quoted string, as it appears in several programming
       languages.  The backslash is used as an escape character that indicates
       that the next character is to be taken literally, as another character
       for the string.  Therefore, after the opening quote, we expect a
       (possibly empty) sequence of alternatives: either some character except
       an unescaped quote or backslash or an escaped character.

           /"(?:[^"\\]++|\\.)*+"/;

   Building a regexp
       At this point, we have all the basic regexp concepts covered, so let's
       give a more involved example of a regular expression.  We will build a
       regexp that matches numbers.

       The first task in building a regexp is to decide what we want to match
       and what we want to exclude.  In our case, we want to match both
       integers and floating point numbers and we want to reject any string
       decimal point, a fractional part, and an exponent.  One or more of
       these parts is optional, so we need to check out the different
       possibilities.  Floating point numbers which are in proper form include
       123., 0.345, .34, -1e6, and 25.4E-72.  As with integers, the sign out
       front is completely optional and can be matched by "[+-]?".  We can see
       that if there is no exponent, floating point numbers must have a
       decimal point, otherwise they are integers.  We might be tempted to
       model these with "\d*\.\d*", but this would also match just a single
       decimal point, which is not a number.  So the three cases of floating
       point number without exponent are

          /[+-]?\d+\./;  # 1., 321., etc.
          /[+-]?\.\d+/;  # .1, .234, etc.
          /[+-]?\d+\.\d+/;  # 1.0, 30.56, etc.

       These can be combined into a single regexp with a three-way
       alternation:

          /[+-]?(\d+\.\d+|\d+\.|\.\d+)/;  # floating point, no exponent

       In this alternation, it is important to put '\d+\.\d+' before '\d+\.'.
       If '\d+\.' were first, the regexp would happily match that and ignore
       the fractional part of the number.

       Now consider floating point numbers with exponents.  The key
       observation here is that both integers and numbers with decimal points
       are allowed in front of an exponent.  Then exponents, like the overall
       sign, are independent of whether we are matching numbers with or
       without decimal points, and can be 'decoupled' from the mantissa.  The
       overall form of the regexp now becomes clear:

           /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;

       The exponent is an "e" or "E", followed by an integer.  So the exponent
       regexp is

          /[eE][+-]?\d+/;  # exponent

       Putting all the parts together, we get a regexp that matches numbers:

          /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/;  # Ta da!

       Long regexps like this may impress your friends, but can be hard to
       decipher.  In complex situations like this, the "//x" modifier for a
       match is invaluable.  It allows one to put nearly arbitrary whitespace
       and comments into a regexp without affecting their meaning.  Using it,
       we can rewrite our 'extended' regexp in the more pleasing form

          /^
             [+-]?         # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+\.\d+  # mantissa of the form a.b
                |\d+\.     # mantissa of the form a.
                |\.\d+     # mantissa of the form .b

          /^
             [+-]?\ *      # first, match an optional sign *and space*
             (             # then match integers or f.p. mantissas:
                 \d+\.\d+  # mantissa of the form a.b
                |\d+\.     # mantissa of the form a.
                |\.\d+     # mantissa of the form .b
                |\d+       # integer of the form a
             )
             ([eE][+-]?\d+)?  # finally, optionally match an exponent
          $/x;

       In this form, it is easier to see a way to simplify the alternation.
       Alternatives 1, 2, and 4 all start with "\d+", so it could be factored
       out:

          /^
             [+-]?\ *      # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+       # start out with a ...
                 (
                     \.\d* # mantissa of the form a.b or a.
                 )?        # ? takes care of integers of the form a
                |\.\d+     # mantissa of the form .b
             )
             ([eE][+-]?\d+)?  # finally, optionally match an exponent
          $/x;

       or written in the compact form,

           /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;

       This is our final regexp.  To recap, we built a regexp by

       o   specifying the task in detail,

       o   breaking down the problem into smaller parts,

       o   translating the small parts into regexps,

       o   combining the regexps,

       o   and optimizing the final combined regexp.

       These are also the typical steps involved in writing a computer
       program.  This makes perfect sense, because regular expressions are
       essentially programs written in a little computer language that
       specifies patterns.

   Using regular expressions in Perl
       The last topic of Part 1 briefly covers how regexps are used in Perl
       programs.  Where do they fit into Perl syntax?

       We have already introduced the matching operator in its default
       "/regexp/" and arbitrary delimiter "m!regexp!" forms.  We have used the
           while (<>) {
               print if /$pattern/;
           }

       This will print any lines containing the word "Seuss".  It is not as
       efficient as it could be, however, because Perl has to re-evaluate (or
       compile) $pattern each time through the loop.  If $pattern won't be
       changing over the lifetime of the script, we can add the "//o"
       modifier, which directs Perl to only perform variable substitutions
       once:

           #!/usr/bin/perl
           #    Improved simple_grep
           $regexp = shift;
           while (<>) {
               print if /$regexp/o;  # a good deal faster
           }

       Prohibiting substitution

       If you change $pattern after the first substitution happens, Perl will
       ignore it.  If you don't want any substitutions at all, use the special
       delimiter "m''":

           @pattern = ('Seuss');
           while (<>) {
               print if m'@pattern';  # matches literal '@pattern', not 'Seuss'
           }

       Similar to strings, "m''" acts like apostrophes on a regexp; all other
       "m" delimiters act like quotes.  If the regexp evaluates to the empty
       string, the regexp in the last successful match is used instead.  So we
       have

           "dog" =~ /d/;  # 'd' matches
           "dogbert =~ //;  # this matches the 'd' regexp used before

       Global matching

       The final two modifiers "//g" and "//c" concern multiple matches.  The
       modifier "//g" stands for global matching and allows the matching
       operator to match within a string as many times as possible.  In scalar
       context, successive invocations against a string will have `"//g" jump
       from match to match, keeping track of position in the string as it goes
       along.  You can get or set the position with the "pos()" function.

       The use of "//g" is shown in the following example.  Suppose we have a
       string that consists of words separated by spaces.  If we know how many
       words there are in advance, we could extract the words using groupings:

           $x = "cat dog house"; # 3 words
           $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
                                                  # $1 = 'cat'
                                                  # $2 = 'dog'

           Word is cat, ends at position 3
           Word is dog, ends at position 7
           Word is house, ends at position 13

       A failed match or changing the target string resets the position.  If
       you don't want the position reset after failure to match, add the
       "//c", as in "/regexp/gc".  The current position in the string is
       associated with the string, not the regexp.  This means that different
       strings have different positions and their respective positions can be
       set or read independently.

       In list context, "//g" returns a list of matched groupings, or if there
       are no groupings, a list of matches to the whole regexp.  So if we
       wanted just the words, we could use

           @words = ($x =~ /(\w+)/g);  # matches,
                                       # $word[0] = 'cat'
                                       # $word[1] = 'dog'
                                       # $word[2] = 'house'

       Closely associated with the "//g" modifier is the "\G" anchor.  The
       "\G" anchor matches at the point where the previous "//g" match left
       off.  "\G" allows us to easily do context-sensitive matching:

           $metric = 1;  # use metric units
           ...
           $x = <FILE>;  # read in measurement
           $x =~ /^([+-]?\d+)\s*/g;  # get magnitude
           $weight = $1;
           if ($metric) { # error checking
               print "Units error!" unless $x =~ /\Gkg\./g;
           }
           else {
               print "Units error!" unless $x =~ /\Glbs\./g;
           }
           $x =~ /\G\s+(widget|sprocket)/g;  # continue processing

       The combination of "//g" and "\G" allows us to process the string a bit
       at a time and use arbitrary Perl logic to decide what to do next.
       Currently, the "\G" anchor is only fully supported when used to anchor
       to the start of the pattern.

       "\G" is also invaluable in processing fixed length records with
       regexps.  Suppose we have a snippet of coding region DNA, encoded as
       base pair letters "ATCGTTGAAT..." and we want to find all the stop
       codons "TGA".  In a coding region, codons are 3-letter sequences, so we
       can think of the DNA snippet as a sequence of 3-letter records.  The
       naive regexp

           # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
           $dna = "ATCGTTGAATGCAAATGACATGAC";
           $dna =~ /TGA/;

       doesn't work; it may match a "TGA", but there is no guarantee that the
       Position 18 is good, but position 23 is bogus.  What happened?

       The answer is that our regexp works well until we get past the last
       real match.  Then the regexp will fail to match a synchronized "TGA"
       and start stepping ahead one character position at a time, not what we
       want.  The solution is to use "\G" to anchor the match to the codon
       alignment:

           while ($dna =~ /\G(\w\w\w)*?TGA/g) {
               print "Got a TGA stop codon at position ", pos $dna, "\n";
           }

       This prints

           Got a TGA stop codon at position 18

       which is the correct answer.  This example illustrates that it is
       important not only to match what is desired, but to reject what is not
       desired.

       Search and replace

       Regular expressions also play a big role in search and replace
       operations in Perl.  Search and replace is accomplished with the "s///"
       operator.  The general form is "s/regexp/replacement/modifiers", with
       everything we know about regexps and modifiers applying in this case as
       well.  The "replacement" is a Perl double quoted string that replaces
       in the string whatever is matched with the "regexp".  The operator "=~"
       is also used here to associate a string with "s///".  If matching
       against $_, the "$_ =~" can be dropped.  If there is a match, "s///"
       returns the number of substitutions made, otherwise it returns false.
       Here are a few examples:

           $x = "Time to feed the cat!";
           $x =~ s/cat/hacker/;   # $x contains "Time to feed the hacker!"
           if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
               $more_insistent = 1;
           }
           $y = "'quoted words'";
           $y =~ s/^'(.*)'$/$1/;  # strip single quotes,
                                  # $y contains "quoted words"

       In the last example, the whole string was matched, but only the part
       inside the single quotes was grouped.  With the "s///" operator, the
       matched variables $1, $2, etc.  are immediately available for use in
       the replacement expression, so we use $1 to replace the quoted string
       with just what was quoted.  With the global modifier, "s///g" will
       search and replace all occurrences of the regexp in the string:

           $x = "I batted 4 for 4";
           $x =~ s/4/four/;   # doesn't do it all:
                              # $x contains "I batted four for 4"
           $x = "I batted 4 for 4";
           $x =~ s/4/four/g;  # does it all:
           }
           ^D

           % simple_replace regexp regex perlretut.pod

       In "simple_replace" we used the "s///g" modifier to replace all
       occurrences of the regexp on each line and the "s///o" modifier to
       compile the regexp only once.  As with "simple_grep", both the "print"
       and the "s/$regexp/$replacement/go" use $_ implicitly.

       A modifier available specifically to search and replace is the "s///e"
       evaluation modifier.  "s///e" wraps an "eval{...}" around the
       replacement string and the evaluated result is substituted for the
       matched substring.  "s///e" is useful if you need to do a bit of
       computation in the process of replacing text.  This example counts
       character frequencies in a line:

           $x = "Bill the cat";
           $x =~ s/(.)/$chars{$1}++;$1/eg;  # final $1 replaces char with itself
           print "frequency of '$_' is $chars{$_}\n"
               foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);

       This prints

           frequency of ' ' is 2
           frequency of 't' is 2
           frequency of 'l' is 2
           frequency of 'B' is 1
           frequency of 'c' is 1
           frequency of 'e' is 1
           frequency of 'h' is 1
           frequency of 'i' is 1
           frequency of 'a' is 1

       As with the match "m//" operator, "s///" can use other delimiters, such
       as "s!!!" and "s{}{}", and even "s{}//".  If single quotes are used
       "s'''", then the regexp and replacement are treated as single quoted
       strings and there are no substitutions.  "s///" in list context returns
       the same thing as in scalar context, i.e., the number of matches.

       The split function

       The "split()" function is another place where a regexp is used.  "split
       /regexp/, string, limit" separates the "string" operand into a list of
       substrings and returns that list.  The regexp must be designed to match
       whatever constitutes the separators for the desired substrings.  The
       "limit", if present, constrains splitting into no more than "limit"
       number of strings.  For example, to split a string into words, use

           $x = "Calvin and Hobbes";
           @words = split /\s+/, $x;  # $word[0] = 'Calvin'
                                      # $word[1] = 'and'
                                      # $word[2] = 'Hobbes'

                                       # $parts[2] = 'usr'
                                       # $parts[3] = '/'
                                       # $parts[4] = 'bin'
                                       # $parts[5] = '/'
                                       # $parts[6] = 'perl'

       Since the first character of $x matched the regexp, "split" prepended
       an empty initial element to the list.

       If you have read this far, congratulations! You now have all the basic
       tools needed to use regular expressions to solve a wide range of text
       processing problems.  If this is your first time through the tutorial,
       why not stop here and play around with regexps a while...  Part 2
       concerns the more esoteric aspects of regular expressions and those
       concepts certainly aren't needed right at the start.

Part 2: Power tools
       OK, you know the basics of regexps and you want to know more.  If
       matching regular expressions is analogous to a walk in the woods, then
       the tools discussed in Part 1 are analogous to topo maps and a compass,
       basic tools we use all the time.  Most of the tools in part 2 are
       analogous to flare guns and satellite phones.  They aren't used too
       often on a hike, but when we are stuck, they can be invaluable.

       What follows are the more advanced, less used, or sometimes esoteric
       capabilities of Perl regexps.  In Part 2, we will assume you are
       comfortable with the basics and concentrate on the new features.

   More on characters, strings, and character classes
       There are a number of escape sequences and character classes that we
       haven't covered yet.

       There are several escape sequences that convert characters or strings
       between upper and lower case, and they are also available within
       patterns.  "\l" and "\u" convert the next character to lower or upper
       case, respectively:

           $x = "perl";
           $string =~ /\u$x/;  # matches 'Perl' in $string
           $x = "M(rs?|s)\\."; # note the double backslash
           $string =~ /\l$x/;  # matches 'mr.', 'mrs.', and 'ms.',

       A "\L" or "\U" indicates a lasting conversion of case, until terminated
       by "\E" or thrown over by another "\U" or "\L":

           $x = "This word is in lower case:\L SHOUT\E";
           $x =~ /shout/;       # matches
           $x = "I STILL KEYPUNCH CARDS FOR MY 360"
           $x =~ /\Ukeypunch/;  # matches punch card string

       If there is no "\E", case is converted until the end of the string. The
       regexps "\L\u$word" or "\u\L$word" convert the first character of $word
       to uppercase and the rest of the characters to lowercase.

       for representing the alphabets from virtually all of the world's
       written languages, and a host of symbols.  Perl's text strings are
       Unicode strings, so they can contain characters with a value (codepoint
       or character number) higher than 255

       What does this mean for regexps? Well, regexp users don't need to know
       much about Perl's internal representation of strings.  But they do need
       to know 1) how to represent Unicode characters in a regexp and 2) that
       a matching operation will treat the string to be searched as a sequence
       of characters, not bytes.  The answer to 1) is that Unicode characters
       greater than "chr(255)" are represented using the "\x{hex}" notation,
       because the \0 octal and \x hex (without curly braces) don't go further
       than 255.

           /\x{263a}/;  # match a Unicode smiley face :)

       NOTE: In Perl 5.6.0 it used to be that one needed to say "use utf8" to
       use any Unicode features.  This is no more the case: for almost all
       Unicode processing, the explicit "utf8" pragma is not needed.  (The
       only case where it matters is if your Perl script is in Unicode and
       encoded in UTF-8, then an explicit "use utf8" is needed.)

       Figuring out the hexadecimal sequence of a Unicode character you want
       or deciphering someone else's hexadecimal Unicode regexp is about as
       much fun as programming in machine code.  So another way to specify
       Unicode characters is to use the named character> escape sequence
       "\N{name}".  "name" is a name for the Unicode character, as specified
       in the Unicode standard.  For instance, if we wanted to represent or
       match the astrological sign for the planet Mercury, we could use

           use charnames ":full"; # use named chars with Unicode full names
           $x = "abc\N{MERCURY}def";
           $x =~ /\N{MERCURY}/;   # matches

       One can also use short names or restrict names to a certain alphabet:

           use charnames ':full';
           print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";

           use charnames ":short";
           print "\N{greek:Sigma} is an upper-case sigma.\n";

           use charnames qw(greek);
           print "\N{sigma} is Greek sigma\n";

       A list of full names is found in the file NamesList.txt in the
       lib/perl5/X.X.X/unicore directory (where X.X.X is the perl version
       number as it is installed on your system).

       The answer to requirement 2), as of 5.6.0, is that a regexp uses
       Unicode characters. Internally, this is encoded to bytes using either
       UTF-8 or a native 8 bit encoding, depending on the history of the
       string, but conceptually it is a sequence of characters, not bytes. See
       perlunitut for a tutorial about that.
           $x =~ /^\P{IsLower}/;   # matches, char class sans lowercase

       Here is the association between some Perl named classes and the
       traditional Unicode classes:

           Perl class name  Unicode class name or regular expression

           IsAlpha          /^[LM]/
           IsAlnum          /^[LMN]/
           IsASCII          $code <= 127
           IsCntrl          /^C/
           IsBlank          $code =~ /^(0020|0009)$/ || /^Z[^lp]/
           IsDigit          Nd
           IsGraph          /^([LMNPS]|Co)/
           IsLower          Ll
           IsPrint          /^([LMNPS]|Co|Zs)/
           IsPunct          /^P/
           IsSpace          /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
           IsSpacePerl      /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
           IsUpper          /^L[ut]/
           IsWord           /^[LMN]/ || $code eq "005F"
           IsXDigit         $code =~ /^00(3[0-9]|[46][1-6])$/

       You can also use the official Unicode class names with the "\p" and
       "\P", like "\p{L}" for Unicode 'letters', or "\p{Lu}" for uppercase
       letters, or "\P{Nd}" for non-digits.  If a "name" is just one letter,
       the braces can be dropped.  For instance, "\pM" is the character class
       of Unicode 'marks', for example accent marks.  For the full list see
       perlunicode.

       The Unicode has also been separated into various sets of characters
       which you can test with "\p{...}" (in) and "\P{...}" (not in).  To test
       whether a character is (or is not) an element of a script you would use
       the script name, for example "\p{Latin}", "\p{Greek}", or
       "\P{Katakana}". Other sets are the Unicode blocks, the names of which
       begin with "In". One such block is dedicated to mathematical operators,
       and its pattern formula is <C\p{InMathematicalOperators>}>.  For the
       full list see perlunicode.

       "\X" is an abbreviation for a character class that comprises the
       Unicode combining character sequences.  A combining character sequence
       is a base character followed by any number of diacritics, i.e., signs
       like accents used to indicate different sounds of a letter. Using the
       Unicode full names, e.g., "A + COMBINING RING" is a combining character
       sequence with base character "A" and combining character
       "COMBINING RING", which translates in Danish to A with the circle atop
       it, as in the word Angstrom.  "\X" is equivalent to "\PM\pM*}", i.e., a
       non-mark followed by one or more marks.

       For the full and latest information about Unicode see the latest
       Unicode standard, or the Unicode Consortium's website
       http://www.unicode.org/

       As if all those classes weren't enough, Perl also defines POSIX style
       classes can be used just like "\d", with the exception that POSIX
       character classes can only be used inside of a character class:

           /\s+[abc[:digit:]xyz]\s*/;  # match a,b,c,x,y,z, or a digit
           /^=item\s[[:digit:]]/;      # match '=item',
                                       # followed by a space and a digit
           use charnames ":full";
           /\s+[abc\p{IsDigit}xyz]\s+/;  # match a,b,c,x,y,z, or a digit
           /^=item\s\p{IsDigit}/;        # match '=item',
                                         # followed by a space and a digit

       Whew! That is all the rest of the characters and character classes.

   Compiling and saving regular expressions
       In Part 1 we discussed the "//o" modifier, which compiles a regexp just
       once.  This suggests that a compiled regexp is some data structure that
       can be stored once and used again and again.  The regexp quote "qr//"
       does exactly that: "qr/string/" compiles the "string" as a regexp and
       transforms the result into a form that can be assigned to a variable:

           $reg = qr/foo+bar?/;  # reg contains a compiled regexp

       Then $reg can be used as a regexp:

           $x = "fooooba";
           $x =~ $reg;     # matches, just like /foo+bar?/
           $x =~ /$reg/;   # same thing, alternate form

       $reg can also be interpolated into a larger regexp:

           $x =~ /(abc)?$reg/;  # still matches

       As with the matching operator, the regexp quote can use different
       delimiters, e.g., "qr!!", "qr{}" or "qr~~".  Apostrophes as delimiters
       ("qr''") inhibit any interpolation.

       Pre-compiled regexps are useful for creating dynamic matches that don't
       need to be recompiled each time they are encountered.  Using pre-
       compiled regexps, we write a "grep_step" program which greps for a
       sequence of patterns, advancing to the next pattern as soon as one has
       been satisfied.

           % cat > grep_step
           #!/usr/bin/perl
           # grep_step - match <number> regexps, one after the other
           # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...

           $number = shift;
           $regexp[$_] = shift foreach (0..$number-1);
           @compiled = map qr/$_/, @regexp;
           while ($line = <>) {
               if ($line =~ /$compiled[0]/) {
                   print $line;
                   shift @compiled;

       flexibility without sacrificing speed.

   Composing regular expressions at runtime
       Backtracking is more efficient than repeated tries with different
       regular expressions.  If there are several regular expressions and a
       match with any of them is acceptable, then it is possible to combine
       them into a set of alternatives.  If the individual expressions are
       input data, this can be done by programming a join operation.  We'll
       exploit this idea in an improved version of the "simple_grep" program:
       a program that matches multiple patterns:

           % cat > multi_grep
           #!/usr/bin/perl
           # multi_grep - match any of <number> regexps
           # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...

           $number = shift;
           $regexp[$_] = shift foreach (0..$number-1);
           $pattern = join '|', @regexp;

           while ($line = <>) {
               print $line if $line =~ /$pattern/o;
           }
           ^D

           % multi_grep 2 shift for multi_grep
           $number = shift;
           $regexp[$_] = shift foreach (0..$number-1);

       Sometimes it is advantageous to construct a pattern from the input that
       is to be analyzed and use the permissible values on the left hand side
       of the matching operations.  As an example for this somewhat
       paradoxical situation, let's assume that our input contains a command
       verb which should match one out of a set of available command verbs,
       with the additional twist that commands may be abbreviated as long as
       the given string is unique. The program below demonstrates the basic
       algorithm.

           % cat > keymatch
           #!/usr/bin/perl
           $kwds = 'copy compare list print';
           while( $command = <> ){
               $command =~ s/^\s+|\s+$//g;  # trim leading and trailing spaces
               if( ( @matches = $kwds =~ /\b$command\w*/g ) == 1 ){
                   print "command: '@matches'\n";
               } elsif( @matches == 0 ){
                   print "no such command: '$command'\n";
               } else {
                   print "not unique: '$command' (could be one of: @matches)\n";
               }
           }
           ^D

           % keymatch

       tells us the number of matches ("scalar @matches") and all the keywords
       that were actually matched.  You could hardly ask for more.

   Embedding comments and modifiers in a regular expression
       Starting with this section, we will be discussing Perl's set of
       extended patterns.  These are extensions to the traditional regular
       expression syntax that provide powerful new tools for pattern matching.
       We have already seen extensions in the form of the minimal matching
       constructs "??", "*?", "+?", "{n,m}?", and "{n,}?".  The rest of the
       extensions below have the form "(?char...)", where the "char" is a
       character that determines the type of extension.

       The first extension is an embedded comment "(?#text)".  This embeds a
       comment into the regular expression without affecting its meaning.  The
       comment should not have any closing parentheses in the text.  An
       example is

           /(?# Match an integer:)[+-]?\d+/;

       This style of commenting has been largely superseded by the raw,
       freeform commenting that is allowed with the "//x" modifier.

       The modifiers "//i", "//m", "//s" and "//x" (or any combination
       thereof) can also be embedded in a regexp using "(?i)", "(?m)", "(?s)",
       and "(?x)".  For instance,

           /(?i)yes/;  # match 'yes' case insensitively
           /yes/i;     # same thing
           /(?x)(          # freeform version of an integer regexp
                    [+-]?  # match an optional sign
                    \d+    # match a sequence of digits
                )
           /x;

       Embedded modifiers can have two important advantages over the usual
       modifiers.  Embedded modifiers allow a custom set of modifiers to each
       regexp pattern.  This is great for matching an array of regexps that
       must have different modifiers:

           $pattern[0] = '(?i)doctor';
           $pattern[1] = 'Johnson';
           ...
           while (<>) {
               foreach $patt (@pattern) {
                   print if /$patt/;
               }
           }

       The second advantage is that embedded modifiers (except "//p", which
       modifies the entire regexp) only affect the regexp inside the group the
       embedded modifier is contained in.  So grouping can be used to localize
       the modifier's effects:

           /Answer: ((?i)yes)/;  # matches 'Answer: yes', 'Answer: YES', etc.

       a little background.

       In Perl regular expressions, most regexp elements 'eat up' a certain
       amount of string when they match.  For instance, the regexp element
       "[abc}]" eats up one character of the string when it matches, in the
       sense that Perl moves to the next character position in the string
       after the match.  There are some elements, however, that don't eat up
       characters (advance the character position) if they match.  The
       examples we have seen so far are the anchors.  The anchor "^" matches
       the beginning of the line, but doesn't eat any characters.  Similarly,
       the word boundary anchor "\b" matches wherever a character matching
       "\w" is next to a character that doesn't, but it doesn't eat up any
       characters itself.  Anchors are examples of zero-width assertions.
       Zero-width, because they consume no characters, and assertions, because
       they test some property of the string.  In the context of our walk in
       the woods analogy to regexp matching, most regexp elements move us
       along a trail, but anchors have us stop a moment and check our
       surroundings.  If the local environment checks out, we can proceed
       forward.  But if the local environment doesn't satisfy us, we must
       backtrack.

       Checking the environment entails either looking ahead on the trail,
       looking behind, or both.  "^" looks behind, to see that there are no
       characters before.  "$" looks ahead, to see that there are no
       characters after.  "\b" looks both ahead and behind, to see if the
       characters on either side differ in their "word-ness".

       The lookahead and lookbehind assertions are generalizations of the
       anchor concept.  Lookahead and lookbehind are zero-width assertions
       that let us specify which characters we want to test for.  The
       lookahead assertion is denoted by "(?=regexp)" and the lookbehind
       assertion is denoted by "(?<=fixed-regexp)".  Some examples are

           $x = "I catch the housecat 'Tom-cat' with catnip";
           $x =~ /cat(?=\s)/;   # matches 'cat' in 'housecat'
           @catwords = ($x =~ /(?<=\s)cat\w+/g);  # matches,
                                                  # $catwords[0] = 'catch'
                                                  # $catwords[1] = 'catnip'
           $x =~ /\bcat\b/;  # matches 'cat' in 'Tom-cat'
           $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
                                     # middle of $x

       Note that the parentheses in "(?=regexp)" and "(?<=regexp)" are non-
       capturing, since these are zero-width assertions.  Thus in the second
       regexp, the substrings captured are those of the whole regexp itself.
       Lookahead "(?=regexp)" can match arbitrary regexps, but lookbehind
       "(?<=fixed-regexp)" only works for regexps of fixed width, i.e., a
       fixed number of characters long.  Thus "(?<=(ab|bc))" is fine, but
       "(?<=(ab)*)" is not.  The negated versions of the lookahead and
       lookbehind assertions are denoted by "(?!regexp)" and
       "(?<!fixed-regexp)" respectively.  They evaluate true if the regexps do
       not match:

           $x = "foobar";

           $str = "one two - --6-8";
           @toks = split / \s+              # a run of spaces
                         | (?<=\S) (?=-)    # any non-space followed by '-'
                         | (?<=-)  (?=\S)   # a '-' followed by any non-space
                         /x, $str;          # @toks = qw(one two - - - 6 - 8)

   Using independent subexpressions to prevent backtracking
       Independent subexpressions are regular expressions, in the context of a
       larger regular expression, that function independently of the larger
       regular expression.  That is, they consume as much or as little of the
       string as they wish without regard for the ability of the larger regexp
       to match.  Independent subexpressions are represented by "(?>regexp)".
       We can illustrate their behavior by first considering an ordinary
       regexp:

           $x = "ab";
           $x =~ /a*ab/;  # matches

       This obviously matches, but in the process of matching, the
       subexpression "a*" first grabbed the "a".  Doing so, however, wouldn't
       allow the whole regexp to match, so after backtracking, "a*" eventually
       gave back the "a" and matched the empty string.  Here, what "a*"
       matched was dependent on what the rest of the regexp matched.

       Contrast that with an independent subexpression:

           $x =~ /(?>a*)ab/;  # doesn't match!

       The independent subexpression "(?>a*)" doesn't care about the rest of
       the regexp, so it sees an "a" and grabs it.  Then the rest of the
       regexp "ab" cannot match.  Because "(?>a*)" is independent, there is no
       backtracking and the independent subexpression does not give up its
       "a".  Thus the match of the regexp as a whole fails.  A similar
       behavior occurs with completely independent regexps:

           $x = "ab";
           $x =~ /a*/g;   # matches, eats an 'a'
           $x =~ /\Gab/g; # doesn't match, no 'a' available

       Here "//g" and "\G" create a 'tag team' handoff of the string from one
       regexp to the other.  Regexps with an independent subexpression are
       much like this, with a handoff of the string to the independent
       subexpression, and a handoff of the string back to the enclosing
       regexp.

       The ability of an independent subexpression to prevent backtracking can
       be quite useful.  Suppose we want to match a non-empty string enclosed
       in parentheses up to two levels deep.  Then the following regexp
       matches:

           $x = "abc(de(fg)h";  # unbalanced parentheses
           $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;

           $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;

       Here, "(?>[^()]+)" breaks the degeneracy of string partitioning by
       gobbling up as much of the string as possible and keeping it.   Then
       match failures fail much more quickly.

   Conditional expressions
       A conditional expression is a form of if-then-else statement that
       allows one to choose which patterns are to be matched, based on some
       condition.  There are two types of conditional expression:
       "(?(condition)yes-regexp)" and "(?(condition)yes-regexp|no-regexp)".
       "(?(condition)yes-regexp)" is like an 'if () {}' statement in Perl.  If
       the "condition" is true, the "yes-regexp" will be matched.  If the
       "condition" is false, the "yes-regexp" will be skipped and Perl will
       move onto the next regexp element.  The second form is like an
       'if () {} else {}' statement in Perl.  If the "condition" is true, the
       "yes-regexp" will be matched, otherwise the "no-regexp" will be
       matched.

       The "condition" can have several forms.  The first form is simply an
       integer in parentheses "(integer)".  It is true if the corresponding
       backreference "\integer" matched earlier in the regexp.  The same thing
       can be done with a name associated with a capture buffer, written as
       "(<name>)" or "('name')".  The second form is a bare zero width
       assertion "(?...)", either a lookahead, a lookbehind, or a code
       assertion (discussed in the next section).  The third set of forms
       provides tests that return true if the expression is executed within a
       recursion ("(R)") or is being called from some capturing group,
       referenced either by number ("(R1)", "(R2)",...) or by name
       ("(R&name)").

       The integer or name form of the "condition" allows us to choose, with
       more flexibility, what to match based on what matched earlier in the
       regexp. This searches for words of the form "$x$x" or "$x$y$y$x":

           % simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
           beriberi
           coco
           couscous
           deed
           ...
           toot
           toto
           tutu

       The lookbehind "condition" allows, along with backreferences, an
       earlier part of the match to influence a later part of the match.  For
       instance,

           /[ATGC]+(?(?<=AA)G|C)$/;

       matches a DNA sequence such that it either ends in "AAG", or some other
       base pair combination and "C".  Note that the form is "(?(?<=AA)G|C)"
       and not "(?((?<=AA))G|C)"; for the lookahead, lookbehind or code
       subpatterns that are used more than once are the optional sign, the
       digit sequence for an integer and the decimal fraction.  The DEFINE
       group at the end of the pattern contains their definition.  Notice that
       the decimal fraction pattern is the first place where we can reuse the
       integer pattern.

          /^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) )
             (?: [eE](?&osg)(?&int) )?
           $
           (?(DEFINE)
             (?<osg>[-+]?)         # optional sign
             (?<int>\d++)          # integer
             (?<dec>\.(?&int))     # decimal fraction
           )/x

   Recursive patterns
       This feature (introduced in Perl 5.10) significantly extends the power
       of Perl's pattern matching.  By referring to some other capture group
       anywhere in the pattern with the construct "(?group-ref)", the pattern
       within the referenced group is used as an independent subpattern in
       place of the group reference itself.  Because the group reference may
       be contained within the group it refers to, it is now possible to apply
       pattern matching to tasks that hitherto required a recursive parser.

       To illustrate this feature, we'll design a pattern that matches if a
       string contains a palindrome. (This is a word or a sentence that, while
       ignoring spaces, interpunctuation and case, reads the same backwards as
       forwards. We begin by observing that the empty string or a string
       containing just one word character is a palindrome. Otherwise it must
       have a word character up front and the same at its end, with another
       palindrome in between.

           /(?: (\w) (?...Here be a palindrome...) \g{-1} | \w? )/x

       Adding "\W*" at either end to eliminate what is to be ignored, we
       already have the full pattern:

           my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix;
           for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){
               print "'$s' is a palindrome\n" if $s =~ /$pp/;
           }

       In "(?...)" both absolute and relative backreferences may be used.  The
       entire pattern can be reinserted with "(?R)" or "(?0)".  If you prefer
       to name your buffers, you can use "(?&name)" to recurse into that
       buffer.

   A bit of magic: executing Perl code in a regular expression
       Normally, regexps are a part of Perl expressions.  Code evaluation
       expressions turn that around by allowing arbitrary Perl code to be a
       part of a regexp.  A code evaluation expression is denoted "(?{code})",
       with code a string of Perl statements.

       Be warned that this feature is considered experimental, and may be

           $x = "abcdef";
           $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
                                                # prints 'Hi Mom!'
           $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
                                                # no 'Hi Mom!'

       Pay careful attention to the next example:

           $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
                                                # no 'Hi Mom!'
                                                # but why not?

       At first glance, you'd think that it shouldn't print, because obviously
       the "ddd" isn't going to match the target string. But look at this
       example:

           $x =~ /abc(?{print "Hi Mom!";})[d]dd/; # doesn't match,
                                                  # but _does_ print

       Hmm. What happened here? If you've been following along, you know that
       the above pattern should be effectively the same as the last one --
       enclosing the d in a character class isn't going to change what it
       matches. So why does the first not print while the second one does?

       The answer lies in the optimizations the regex engine makes. In the
       first case, all the engine sees are plain old characters (aside from
       the "?{}" construct). It's smart enough to realize that the string
       'ddd' doesn't occur in our target string before actually running the
       pattern through. But in the second case, we've tricked it into thinking
       that our pattern is more complicated than it is. It takes a look, sees
       our character class, and decides that it will have to actually run the
       pattern to determine whether or not it matches, and in the process of
       running it hits the print statement before it discovers that we don't
       have a match.

       To take a closer look at how the engine does optimizations, see the
       section "Pragmas and debugging" below.

       More fun with "?{}":

           $x =~ /(?{print "Hi Mom!";})/;       # matches,
                                                # prints 'Hi Mom!'
           $x =~ /(?{$c = 1;})(?{print "$c";})/;  # matches,
                                                  # prints '1'
           $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
                                                  # prints '1'

       The bit of magic mentioned in the section title occurs when the regexp
       backtracks in the process of searching for a match.  If the regexp
       backtracks over a code expression and if the variables used within are
       localized using "local", the changes in the variables produced by the
       code expression are undone! Thus, if we wanted to count how many times
       a character got matched inside a group, we could use, e.g.,

       This prints

           'a' count is 2, $c variable is 'bob'

       If we replace the " (?{local $c = $c + 1;})" with " (?{$c = $c + 1;})",
       the variable changes are not undone during backtracking, and we get

           'a' count is 4, $c variable is 'bob'

       Note that only localized variable changes are undone.  Other side
       effects of code expression execution are permanent.  Thus

           $x = "aaaa";
           $x =~ /(a(?{print "Yow\n";}))*aa/;

       produces

          Yow
          Yow
          Yow
          Yow

       The result $^R is automatically localized, so that it will behave
       properly in the presence of backtracking.

       This example uses a code expression in a conditional to match a
       definite article, either 'the' in English or 'der|die|das' in German:

           $lang = 'DE';  # use German
           ...
           $text = "das";
           print "matched\n"
               if $text =~ /(?(?{
                                 $lang eq 'EN'; # is the language English?
                                })
                              the |             # if so, then match 'the'
                              (der|die|das)     # else, match 'der|die|das'
                            )
                           /xi;

       Note that the syntax here is "(?(?{...})yes-regexp|no-regexp)", not
       "(?((?{...}))yes-regexp|no-regexp)".  In other words, in the case of a
       code expression, we don't need the extra parentheses around the
       conditional.

       If you try to use code expressions with interpolating variables, Perl
       may surprise you:

           $bar = 5;
           $pat = '(?{ 1 })';
           /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
           /foo(?{ 1 })$bar/;   # compile error!
           /foo${pat}bar/;      # compile error!

       programmers who write search engines often take user input and plug it
       directly into a regexp:

           $regexp = <>;       # read user-supplied regexp
           $chomp $regexp;     # get rid of possible newline
           $text =~ /$regexp/; # search $text for the $regexp

       If the $regexp variable contains a code expression, the user could then
       execute arbitrary Perl code.  For instance, some joker could search for
       "system('rm -rf *');" to erase your files.  In this sense, the
       combination of interpolation and code expressions taints your regexp.
       So by default, using both interpolation and code expressions in the
       same regexp is not allowed.  If you're not concerned about malicious
       users, it is possible to bypass this security check by invoking
       "use re 'eval'":

           use re 'eval';       # throw caution out the door
           $bar = 5;
           $pat = '(?{ 1 })';
           /foo(?{ 1 })$bar/;   # compiles ok
           /foo${pat}bar/;      # compiles ok

       Another form of code expression is the pattern code expression.  The
       pattern code expression is like a regular code expression, except that
       the result of the code evaluation is treated as a regular expression
       and matched immediately.  A simple example is

           $length = 5;
           $char = 'a';
           $x = 'aaaaabb';
           $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'

       This final example contains both ordinary and pattern code expressions.
       It detects whether a binary string 1101010010001... has a Fibonacci
       spacing 0,1,1,2,3,5,...  of the 1's:

           $x = "1101010010001000001";
           $z0 = ''; $z1 = '0';   # initial conditions
           print "It is a Fibonacci sequence\n"
               if $x =~ /^1         # match an initial '1'
                           (?:
                              ((??{ $z0 })) # match some '0'
                              1             # and then a '1'
                              (?{ $z0 = $z1; $z1 .= $^N; })
                           )+   # repeat as needed
                         $      # that is all there is
                        /x;
           printf "Largest sequence matched was %d\n", length($z1)-length($z0);

       Remember that $^N is set to whatever was matched by the last completed
       capture group. This prints

           It is a Fibonacci sequence
           Largest sequence matched was 5

       which shows that spaces are still possible in the code parts.
       Nevertheless, when working with code and conditional expressions, the
       extended form of regexps is almost necessary in creating and debugging
       regexps.

   Backtracking control verbs
       Perl 5.10 introduced a number of control verbs intended to provide
       detailed control over the backtracking process, by directly influencing
       the regexp engine and by providing monitoring techniques.  As all the
       features in this group are experimental and subject to change or
       removal in a future version of Perl, the interested reader is referred
       to "Special Backtracking Control Verbs" in perlre for a detailed
       description.

       Below is just one example, illustrating the control verb "(*FAIL)",
       which may be abbreviated as "(*F)". If this is inserted in a regexp it
       will cause to fail, just like at some mismatch between the pattern and
       the string. Processing of the regexp continues like after any "normal"
       failure, so that, for instance, the next position in the string or
       another alternative will be tried. As failing to match doesn't preserve
       capture buffers or produce results, it may be necessary to use this in
       combination with embedded code.

          %count = ();
          "supercalifragilisticexpialidoceous" =~
              /([aeiou])(?{ $count{$1}++; })(*FAIL)/oi;
          printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);

       The pattern begins with a class matching a subset of letters.  Whenever
       this matches, a statement like "$count{'a'}++;" is executed,
       incrementing the letter's counter. Then "(*FAIL)" does what it says,
       and the regexp  engine proceeds according to the book: as long as the
       end of the string  hasn't been reached, the position is advanced before
       looking for another vowel. Thus, match or no match makes no difference,
       and the regexp engine proceeds until the the entire string has been
       inspected.  (It's remarkable that an alternative solution using
       something like

          $count{lc($_)}++ for split('', "supercalifragilisticexpialidoceous");
          printf "%3d '%s'\n", $count2{$_}, $_ for ( qw{ a e i o u } );

       is considerably slower.)

   Pragmas and debugging
       Speaking of debugging, there are several pragmas available to control
       and debug regexps in Perl.  We have already encountered one pragma in
       the previous section, "use re 'eval';", that allows variable
       interpolation and code expressions to coexist in a regexp.  The other
       pragmas are

           use re 'taint';
           $tainted = <>;
           @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted

           /^(.*)$/s;       # output debugging info in living color

       The global "debug" and "debugcolor" pragmas allow one to get detailed
       debugging info about regexp compilation and execution.  "debugcolor" is
       the same as debug, except the debugging information is displayed in
       color on terminals that can display termcap color sequences.  Here is
       example output:

           % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
           Compiling REx `a*b+c'
           size 9 first at 1
              1: star(4)
              2:   EXACT <a>(0)
              4: plus(7)
              5:   EXACT <b>(0)
              7: EXACT <c>(9)
              9: end(0)
           floating `bc' at 0..2147483647 (checking floating) minlen 2
           Guessing start of match, REx `a*b+c' against `abc'...
           Found floating substr `bc' at offset 1...
           Guessed: match at offset 0
           Matching REx `a*b+c' against `abc'
             Setting an EVAL scope, savestack=3
              0 <> <abc>             |  1:  STAR
                                      EXACT <a> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              1 <a> <bc>             |  4:    PLUS
                                      EXACT <b> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              2 <ab> <c>             |  7:      EXACT <c>
              3 <abc> <>             |  9:      END
           Match successful!
           Freeing REx: `a*b+c'

       If you have gotten this far into the tutorial, you can probably guess
       what the different parts of the debugging output tell you.  The first
       part

           Compiling REx `a*b+c'
           size 9 first at 1
              1: star(4)
              2:   EXACT <a>(0)
              4: plus(7)
              5:   EXACT <b>(0)
              7: EXACT <c>(9)
              9: end(0)

       describes the compilation stage.  star(4) means that there is a starred
       object, in this case 'a', and if it matches, goto line 4, i.e.,
       plus(7).  the middle lines describe some heuristics and optimizations
       performed before a match:

           floating `bc' at 0..2147483647 (checking floating) minlen 2
           Guessing start of match, REx `a*b+c' against `abc'...
                                      EXACT <b> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              2 <ab> <c>             |  7:      EXACT <c>
              3 <abc> <>             |  9:      END
           Match successful!
           Freeing REx: `a*b+c'

       Each step is of the form "n <x> <y>", with "<x>" the part of the string
       matched and "<y>" the part not yet matched.  The "|  1:  STAR" says
       that Perl is at line number 1 n the compilation list above.  See
       "Debugging regular expressions" in perldebguts for much more detail.

       An alternative method of debugging regexps is to embed "print"
       statements within the regexp.  This provides a blow-by-blow account of
       the backtracking in an alternation:

           "that this" =~ m@(?{print "Start at position ", pos, "\n";})
                            t(?{print "t1\n";})
                            h(?{print "h1\n";})
                            i(?{print "i1\n";})
                            s(?{print "s1\n";})
                                |
                            t(?{print "t2\n";})
                            h(?{print "h2\n";})
                            a(?{print "a2\n";})
                            t(?{print "t2\n";})
                            (?{print "Done at position ", pos, "\n";})
                           @x;

       prints

           Start at position 0
           t1
           h1
           t2
           h2
           a2
           t2
           Done at position 4

BUGS
       Code expressions, conditional expressions, and independent expressions
       are experimental.  Don't use them in production code.  Yet.

SEE ALSO
       This is just a tutorial.  For the full story on Perl regular
       expressions, see the perlre regular expressions reference page.

       For more information on the matching "m//" and substitution "s///"
       operators, see "Regexp Quote-Like Operators" in perlop.  For
       information on the "split" operation, see "split" in perlfunc.

       For an excellent all-around resource on the care and feeding of regular
       expressions, see the book Mastering Regular Expressions by Jeffrey
       Haworth, Ronald J Kimball, and Joe Smith for all their helpful
       comments.



Find all the song lyrics here: Lyrics Now!